Site WWW de Laurent Bloch
Slogan du site

ISSN 2271-3905
Cliquez ici si vous voulez visiter mon autre site, orienté vers des sujets moins techniques.

Pour recevoir (au plus une fois par semaine) les nouveautés de ce site, indiquez ici votre adresse électronique :

Algorithmes pour la biologie

Cette rubrique regroupe des articles et des documents de travail à l’intention des auditeurs du cursus de Bioinformatique du CNAM (principalement, cours BNF 103), ainsi bien sûr que de tout lecteur intéressé par la bioinformatique.

Cette rubrique regroupe des articles et des documents de travail à l’intention des auditeurs du cursus de Bioinformatique du CNAM (principalement, cours BNF 103), ainsi bien sûr que de tout lecteur intéressé par la bioinformatique.

Les derniers articles

Avec Rust : scores de similitude d’une séquence biologique contre une banque
Publié le 25 octobre 2021
par Laurent Bloch

L’article précédent nous avait permis de lire une banque de séquences biologiques au format FASTA, en introduisant à cette occasion l’instruction match et quelques subtilités de la possession, du prêt et de l’emprunt de valeurs. Celui d’avant nous avait donné l’algorithme de Needleman et Wunsch pour (...)

Lire une banque de séquences biologiques avec Rust
Publié le 12 octobre 2021
par Laurent Bloch

Mon article précédent consacré à Rust donne une version de l’algorithme classique de Needleman et Wunsch pour l’alignement de séquences biologiques : chacune des séquences est enregistrée dans un fichier FASTA, le programme lit les deux fichiers et calcule le score de similitude en fonction des coûts de (...)

Python et Biopython
Publié le 12 octobre 2021
par Laurent Bloch
Python, Scheme, C
Publié le 12 octobre 2021
par Laurent Bloch
Une banque de séquences au format FASTA
Publié le 12 octobre 2021
par Laurent Bloch

C’est une petite banque de séquences extraites de génomes d’orchidées : >gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG (...)