Une banque de séquences au format FASTA
Article mis en ligne le 12 octobre 2021

par Laurent Bloch

C’est une petite banque de séquences extraites de génomes d’orchidées :

  1. >gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  2. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG
  3. AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG
  4. CCGCCTCGGGAGCGTCCATGGCGGGTTTGAACCTCTAGCCCGGCGCAGTTTGGGCGCCAAGCCATATGAA
  5. AGCATCACCGGCGAATGGCATTGTCTTCCCCAAAACCCGGAGCGGCGGCGTGCTGTCGCGTGCCCAATGA
  6. ATTTTGATGACTCTCGCAAACGGGAATCTTGGCTCTTTGCATCGGATGGAAGGACGCAGCGAAATGCGAT
  7. AAGTGGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCGCCCGAGGCCATCA
  8. GGCTAAGGGCACGCCTGCTTGGGCGTCGCGCTTCGTCTCTCTCCTGCCAATGCTTGCCCGGCATACAGCC
  9. AGGCCGGCGTGGTGCGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGCGGGTCCAAGAGCTGGTGT
  10. TTTGATGGCCCGGAACCCGGCAAGAGGTGGACGGATGCTGGCAGCAGCTGCCGTGCGAATCCCCCATGTT
  11. GTCGTGCTTGTCGGACAGGCAGGAGAACCCTTCCGAACCCCAATGGAGGGCGGTTGACCGCCATTCGGAT
  12. GTGACCCCAGGTCAGGCGGGGGCACCCGCTGAGTTTACGC
  13.  
  14. >gi|2765657|emb|Z78532.1|CCZ78532 C.californicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  15. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAACAGAATATATGATCGAGTG
  16. AATCTGGAGGACCTGTGGTAACTCAGCTCGTCGTGGCACTGCTTTTGTCGTGACCCTGCTTTGTTGTTGG
  17. GCCTCCTCAAGAGCTTTCATGGCAGGTTTGAACTTTAGTACGGTGCAGTTTGCGCCAAGTCATATAAAGC
  18. ATCACTGATGAATGACATTATTGTCAGAAAAAATCAGAGGGGCAGTATGCTACTGAGCATGCCAGTGAAT
  19. TTTTATGACTCTCGCAACGGATATCTTGGCTCTAACATCGATGAAGAACGCAGCTAAATGCGATAAGTGG
  20. TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAGGCCATCAGGCTAAG
  21. GGCACGCCTGCCTGGGCGTCGTGTGTTGCGTCTCTCCTACCAATGCTTGCTTGGCATATCGCTAAGCTGG
  22. CATTATACGGATGTGAATGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGTTGCTTTGATG
  23. GGTAGGAATGTGGCACGAGGTGGAGAATGCTAACAGTCATAAGGCTGCTATTTGAATCCCCCATGTTGTT
  24. GTATTTTTTCGAACCTACACAAGAACCTAATTGAACCCCAATGGAGCTAAAATAACCATTGGGCAGTTGA
  25. TTTCCATTCAGATGCGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTGAGGC
  26.  
  27. >gi|2765656|emb|Z78531.1|CFZ78531 C.fasciculatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  28. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAACATACGATCGAGTG
  29. AATCCGGAGGACCCGTGGTTACACGGCTCACCGTGGCTTTGCTCTCGTGGTGAACCCGGTTTGCGACCGG
  30. GCCGCCTCGGGAACTTTCATGGCGGGTTTGAACGTCTAGCGCGGCGCAGTTTGCGCCAAGTCATATGGAG
  31. CGTCACCGATGGATGGCATTTTTGTCAAGAAAAACTCGGAGGGGCGGCGTCTGTTGCGCGTGCCAATGAA
  32. TTTATGACGACTCTCGGCAACGGGATATCTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAG
  33. TGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCT
  34. AAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGATAATGCTTGATTGGCATGCGGCTAGTC
  35. TGTCATTGTGAGGACGTGAAAGATTGGCCCCTTGCGCCTAGGTGCGGCGGGTCTAAGCATCGGTGTTCTG
  36. ATGGCCCGGAACTTGGCAGTAGGTGGAGGATGCTGGCAGCCGCAAGGCTGCCGTTCGAATCCCCCGTGTT
  37. GTCGTACTCGTCAGGCCTACAGAAGAACCTGTTTGAACCCCCAGTGGACGCAAAACCGCCCTCGGGCGGT
  38. GATTTCCATTCAGATGCGACCCCAGTCAGGCGGGCCACCCGTGAGTAA
  39.  
  40. >gi|2765655|emb|Z78530.1|CMZ78530 C.margaritaceum 5.8S rRNA gene and ITS1 and ITS2 DNA
  41. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAAACAACATAATAAACGATTGAGTG
  42. AATCTGGAGGACTTGTGGTAATTTGGCTCGCTAGGGATATCCTTTTGTGGTGACCATGATTTGTCATTGG
  43. GCCTCATTGAGAGCTTTCATGGCGGGTTTGAACCTCTAGCACGGTCCAGTTTGCACCAAGGTATATAAAG
  44. AATCACCGATGAATGACATTATTGCCCCACACAACGTCGGAGGTGTGGTGTGTTAATGTTCATTCCAATG
  45. AATTTTGATGACTCTCGGCAGACGGATATCTTGACTCTTGCATCGATGAAGAACGCACCGAAATGTGATA
  46. AGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGG
  47. CTAAGGGCACGCCTGCCTGGGCGTCGTATGTTTTATCTCTCCTTCCAATGCTTGTCCAGCATATAGCTAG
  48. GCCATCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATATGTGTTT
  49. TGATGGTCTGAAACTTGGCAAGAGGTGGAGGATGCTGGCAGCCGCAAGGCTATTGTTTGAATCCCCCATG
  50. TTGTCATGTTTGTTGGGCCTATAGAACAACTTGTTTGGACCCTAATTAAGGCAAAACAATCCTTGGGTGG
  51. TTGATTTCCAATCAGATGCGACCCCAGTCAGGGGGCCACCCCAT
  52.  
  53. >gi|2765654|emb|Z78529.1|CLZ78529 C.lichiangense 5.8S rRNA gene and ITS1 and ITS2 DNA
  54. ACGGCGAGCTGCCGAAGGACATTGTTGAGACAGCAGAATATACGATTGAGTGAATCTGGAGGACTTGTGG
  55. TTATTTGGCTCGCTAGGGATTTCCTTTTGTGGTGACCATGATTTGTCATTGGGCCTCATTGAGAGCTTTC
  56. ATGGCGGGTTTGAACCTCTAGCACGGTGCAGTTTGCACCAAGGTATATAAAGAATCACCGATGAATGACA
  57. TTATTGTCAAAAAAGTCGGAGGTGTGGTGTGTTATTGGTCATGCCAATGAATTGTTGATGACTCTCGCCG
  58. AGGGATATCTTGGCTCTTGCATCGATGAAGAATCCCACCGAAATGTGATAAGTGGTGTGAATTGCAGAAT
  59. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGG
  60. GCGTCGTATGTTTTATCTCTCCTTCCAATGCTTGTCCAGCATATAGCTAGGCCATCATTGTGTGGATGTG
  61. AAAGATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATATGTGTTTTGATGGTCTGAAACTTGGCA
  62. AGAGGTGGAGGATGCTGGCAGCCGCAAGGCTATTGTTTGAATCCCCCATGTTGTCATATTTGTTGGGCCT
  63. ATAGAACAACTTGTTTGGACCCTAATTAAGGCAAAACAATCCTTGGGTGGTTGATTTCCAATCAGATGCG
  64. ACCCCAGTCAGCGGGCCACCAGCTGAGCTAAAA
  65.  
  66. >gi|2765652|emb|Z78527.1|CYZ78527 C.yatabeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  67. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTG
  68. AATCTGGATGACCTGTGGTTACTCGGCTCGCCTGATTTGTTGTTGGGCTTCCTTAGGAGCTTACATGGCG
  69. GGTTTGAACCTCTACCACGGTGCAGTTTGCGCCAAGTCATATGAAGCATAACTGCAAATGGCACTACTGT
  70. CACCAAAAGTTGGAGTGGCAGTGTGTTATTGCATGCGCTAATGGATTTTTGATGACTCTCGGCCAACGGA
  71. TATCTGGCTCTTTGCATCGATGAAGGAACGCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGC
  72. GAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTC
  73. GTGTATCGCATCTCTCTTGCCAATGCTTACCCGGCATACAACTAGGCTGGCATTGGGTGGATGTGAAAGA
  74. TTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGATGTTTTGATGGATCGAAACCTGGCAGGAGG
  75. TGGAGGATGCTGGAAGCCGCAAGGCTGTCGTTCGAATCCCCCATGTTGTCATATTTGTCGAACCTATAAA
  76. AGAACATGCTTGAACCCCAATGGATTGTAAAATGACCCTTGGCGGTTGATTTCCATTTAGATGCGACCCC
  77. AGGTCAGGCGGGCCACCC
  78.  
  79. >gi|2765651|emb|Z78526.1|CGZ78526 C.guttatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  80. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTG
  81. AATCTGGAGGACCTGTGGTTACTCGGCTCCCCTGATTTGTTGTTGGGCTTCCTTAGGAGCTTACATGCCG
  82. GGTTTGAACCTCTACCACGGTGCAGTTTGCGCCAAGTCATATGAAGCATAACTGAACAATGGCATTATTG
  83. TCACCAAAAGTTGGAGTGGCAGTGTGCTATTGCATGCGCTAATGGATTTTTGATGACTCTCGCCAACGGA
  84. TATCTTGGCTCTTGCATCGATGAAGAACCCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGCG
  85. AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCG
  86. TGTATCGCATCTCTCTTGCCAATGCTTACCCGGCATACAACTAGGCTGGCATTGTGCGGATGTGAAAGAT
  87. TGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGATGTTTTGATGGATCGAAACCTGGCAGGAGGT
  88. GGAGGATGCTGGAAGCCGCAAGGCTGTCGTTCGAATCCCCCATGTTGTCATATTTGTCGAACCTATAAAA
  89. GAACATGCTTGAACCCCAATGGATGTAAAATGACCCTTGGCGGTTGATTTCCATTTAGATGCGACCCCAG
  90. GTCAGGCGGGGCCACCCGCTGAGTTTATGT
  91.  
  92. >gi|2765650|emb|Z78525.1|CAZ78525 C.acaule 5.8S rRNA gene and ITS1 and ITS2 DNA
  93. TGTTGAGATAGCAGAATATACATCGAGTGAATCCGGAGGACCTGTGGTTATTCGGCTTGCCGAGGGCTTT
  94. GCTTTTGTGGTGACCCAAATTTGTCGTTGGGCCTCCTCGGGAGCTTTCATGGCAGGTTTCAAACTCTAGC
  95. ACGGCACAGTTTGTGCCAAGTCATATGAAGCATCACCGACAAATGACATTATTGTCAAAAAAGTTGGAGG
  96. GGCGGTGTCCTCCTGTGCATGCCGAATATAATTTTGATGACTCTCGACAAGCGGATATCTTGGCTCTTGC
  97. ATCGGATGAAGAACCCAGCGAAATGCGATAAGTGGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTT
  98. TTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGTTGTGTCTC
  99. TCTTGCCAATGCCTGTCCATATATCTAGGCTTGCATTGTGCGGATGCGAAAGATTGGCCCCTTGTGCCTT
  100. GGCGCGTTGGGTCTAAGGAATGTTTTGATGGCCCGAAACTTGGCAGGAGGTGGAGGACATTGGCTGCCAC
  101. AAGGTTGTCATTTAAATCCCCCATGTTATCGTATTTATCGGACCTATATAATAACTTGTTTGAACCCCAG
  102. TGGAGGCAAAATGACCCTTGGATGGTTGACTGCCATTCATATGCGACCCCAGGTCAGGCGGGCCACCCGC
  103. TGCA
  104.  
  105. >gi|2765649|emb|Z78524.1|CFZ78524 C.formosanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  106. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATAGTAGAATATATGATTGAGTG
  107. AATATGGAGGACATGTGGTTACTTGGCTCGTCAGTGCTTTGCTTTTGTGGTGACCTTAATTGGGCCTCCT
  108. TAGGAGCTTTCATGGCGGGTTCAAACCTTTAGCACGGCGCAGTTTGTGCCAAGTCATATAAGCATCCCTG
  109. ATGAATGGCATTGTTGTTAAAAAAGTCGGAGGGGCGGCATGCTGTTGTGCATGCTAATGAATTTTTTGAT
  110. GACTCTCGCAACGGAACTTGGCTCTTTACATCCGATGAAGAACGCAGCGAAATGCGATAAGTGGTGTGAA
  111. TTGCAGAATCCCGTGAACCATCGAGTATTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACG
  112. CCTGCCTGGGCGTCGTGTGCTGCATCTCTCCTNCCAATGCTTGCCCAGCATATAGCTAGGTTAGCATTGT
  113. GCGGATGAAATATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTAGTATTTTGATAGCTCGGAA
  114. CTCGGCAGGAGGTGGAGAATGTTGGTAGCTGCAAGGCTGCCATTTGAATTCCCCATGTTGTCGTATTTGT
  115. TGAACCTATAAAAGAACTTGTTTGAACCCCAATGAAGGAAAAATGACCCTTGGGCGGTTGATTTTCATTC
  116. AGATGCAACCCCAGGTCAGGTGGCCACCCTGAGATTAAGC
  117.  
  118. >gi|2765648|emb|Z78523.1|CHZ78523 C.himalaicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  119. CGTAACCAGGTTTCCGTAGGTGAACCTGCGGCAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  120. AATCCGGTGGACTTGTGGTTACTCAGCTCGACATAGGCTTTGCTTTTGCGGTGACCCTAACTTGTCATTG
  121. GGCCTCCTCCCAAGCTTTCCTTGTGGGTGTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  122. GCATCACTGAGGAATGACATTATTGTCCCAAAAGCTAGAGTGGAAGCGTGCTCTTGCATGCATGCATAAT
  123. GAATTTTTTATTGACTCTCGACATATGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAAC
  124. GCAAGTTGCGCCCGATGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTAT
  125. CAATGCTTTCCTATCATATAGATTGGTTTGCATTGCGTGGATGCGAAAGATTGGCCCCTTGTGCCTAGGT
  126. GCGGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTAT
  127. AAGGCTATCGTTTGAACCCCCCATATTGTCGTGTTTGTCGGACCTAGAGAAGAACCTGTTTGAATCCCAA
  128. TGGAGGCAAACAACCCTCGGGCGGTTGATTGCCATTCATATTGCGACCCAGGTCAGGCGGGGCCACCGCT
  129. GAGTTTAAG
  130.  
  131. >gi|2765647|emb|Z78522.1|CMZ78522 C.macranthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  132. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  133. AATCCGGTGGACTTGTGGTTACTCAGCTCGACATAGGCTTTGCTTTTGCGGTGACCCTAATTTGTCATTG
  134. GGCCTCCCCCCAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  135. GCATCACTGATGAATGACATTATTGTCCAAAAAGTTGGAGTGGAAGCGTGCTATTGCATACATGCAAATG
  136. AATTTTTTATGACTCTCGACATATCGTGGTGTGATCGCAGAATCCCGTGAACCATCGAGTCTTTGAACGC
  137. AAGTTGCGCCCGATGCCATCAGGCTAAGGGAACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCA
  138. ATGGTTATACGTCATATAGACAGGTTTGCATTGCGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGC
  139. GGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATAA
  140. GGCTATCATTTGAATCCCCCATATTGTCGTGTTTGTCGGACCTAGAGAAGAACATGTTTGAATCCCAATG
  141. GGGGCAAACAACCCTCGGGCGGTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGCCACCCGCTGAG
  142.  
  143. >gi|2765646|emb|Z78521.1|CCZ78521 C.calceolus 5.8S rRNA gene and ITS1 and ITS2 DNA
  144. GTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTGAATCCGGTGGACTTG
  145. TGGTTACTCAGCTCGACATAGGCTTGGCTTTGGCGGTGACCCTAATTTGCCATTGGGCCTCCTCCAAAGC
  146. TTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAAGCATCACCGATGAAT
  147. GACATTATTGTCAAAAAGTTGGAGTGGAAGCGTGCTATTGCATGCATGCAAATGAATTTTTTATGACTCT
  148. CGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCAAAATGCGATAAGTGGTGTGAATTGCA
  149. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATCAGGCTAAGGGCACGCCTGC
  150. CTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCATGTCATATAGATAGGTTTGCATTGCGTGGA
  151. TGTGAAAGAATGGCCCCTTGTGCCTAGGTACGGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCT
  152. GGCAGGAGGTGGAGGATGTTGGCAGCTATAAGGCTATCATTTGAATCCCCCATATTGTCGTGTTTGTCGG
  153. ACCTAGAGAAAAACATGTTTGAATCCCAATGGAGGCAAACAACTCTCGGGCGGTTGATTGCCATTCATAT
  154. GCGACCCCAGGTCAGGCGGGGCCACC
  155.  
  156. >gi|2765645|emb|Z78520.1|CSZ78520 C.segawai 5.8S rRNA gene and ITS1 and ITS2 DNA
  157. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  158. AATCCGGTGGACTTGTGGTTACTCAGCTCGCCATAGGCTTTGCTTTTGCGGTGACCCTAATTTGTCATTG
  159. GGCCTCCTCCAAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  160. TCATCACCGATGAATGACATTATTGTCCAAAAAGTTGGAGTAGAAGCGTGCTATTGCATGCATGCAATAG
  161. AATATTTTATGACTCTCGACAAGGGATATCTTGGCTCTTGCATCGGATGAAGAACGCAGCGAAATTGTGA
  162. TAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTATGTGAACGCAAGTTGCGCCCGATGCCATCA
  163. GGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCCTGTCATATCGAT
  164. AGGTTTGCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGACTAGTGT
  165. TTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATAAGGTTGTCATGTGAATCCCCCA
  166. TATTGTCGTGTTTGTCGGACCTGGAGAAGAACCTGTTTGAATCCCAATGGAGGCAAACAACCCTCGGGCG
  167. GTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGGCCACCCGCTGAGTTT
  168.  
  169. >gi|2765644|emb|Z78519.1|CPZ78519 C.pubescens 5.8S rRNA gene and ITS1 and ITS2 DNA
  170. ATATGATCGAGTGAATCTGGTGGACTTGTGGTTACTCAGCTCGCCATAGGCTTTGCTTTTGCGGTGACCC
  171. TAATTTGTCATTGGGCCTCCTCCCAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCAC
  172. CAAGTCATATGAAGCATTGCCGATGAATGACATTATTGTCCAAAAGTTGGAGTGGAAGCGTGCTACTGCA
  173. TGCATGCAAATGAATTTTTTTATGACTCTCGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCA
  174. GCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC
  175. CGATGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCCC
  176. ATCATATAGATAGGTTTGCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTA
  177. AGAACTTAATGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATATAAGGCTATC
  178. ATTTGAATCCCCCATATTGTCGCGTTTGTTGGACCTAGAGAAGAACATGTTTGAATCCCAATGGAGGCAA
  179. ACAACCCTCGGGCGGTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTTA
  180.  
  181. >gi|2765643|emb|Z78518.1|CRZ78518 C.reginae 5.8S rRNA gene and ITS1 and ITS2 DNA
  182. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGGAGGATCATTGTTGAGATAGTAGAATATTCGATCGAGTG
  183. AATCCGGAGGACTTGTGGTTACTCGGCTCGTCGAAGGCTTAACTTTTGTGGTGACCCTGATTTGTAGTTG
  184. GGCATCCTCGAGAGCTTTTATGGCGGGTTTGAGCCTCTATCACGGCGCAGTTTGCGCCAAGTCATATGAA
  185. GCATCGCCGACGAATTACATTATTGTCCCCCAAACTCGGATGGACGGTGTGTGTTACGCATACCCGTGAA
  186. CCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTG
  187. TGCTGCATCTCTTTTGCCAATGCTTGCTCGACATACAATTAGGCCAGTATTGCATAGATATGAAAGATTG
  188. ACCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGATGGCCCAAACCCCGGCAGGAGGTGG
  189. AGCATGTTGATAGTCGCAAGGCTGTCGTTCAAATCCCACATGTTGTCGTATTTGCCGGACCCACAGAAGA
  190. ACCTATTTGAACCCCTATGGAGGCAAAACAACCCTTGAGCGATTGATTGCCATTCAGATACGACCCCAGG
  191. TCAGGCGGGGCCACCCGCTGAGTTTTCC
  192.  
  193. >gi|2765642|emb|Z78517.1|CFZ78517 C.flavum 5.8S rRNA gene and ITS1 and ITS2 DNA
  194. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATACGATCGAGTG
  195. AATCCAGAGGACTTGTGGTTACTCGGCTCGTCCAAGTCTTAGCTTTTGTGGCCCTGATTTGTCGTTGGGC
  196. ATCCTCAGGAGATTTTATGGCGGGTTTGAACCTCTATCACGGTGCAGTTTGCGCCAAGTCATATGAAGCA
  197. TCACCGATGAATGACATTATTGTCACAAAAGTCGGATGGGCGGTGTGCTGTTGTGCATGCCAATAAATTT
  198. TTGATGACTCTCGGCCAACGGATATCTTGCTCTTCCATCGATGAAGAACGCAGCGAAATGCGATAAGTGG
  199. TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAG
  200. GGCACGCCTGCCTGGGCGTCGTGTGCTGCATCTCTTTTGCCAATGCTTGCCCGACATACAATTAGGACAG
  201. TATTGCATAGATATGAAAGATTGACCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGGTG
  202. GCCCGAACCCCGGCAGGAGGTGGATCATGTTGATAGTCGCAAGACTGTCATTCAAATCCCACATGTTGTC
  203. GTATTTGTCGGACCCACAGAAGAACCTATTTGAACCCCAATGGAGGCAAAACAACCCTCGAGCGATTGAT
  204. TGCCATTCAGATACGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTTAAGC
  205.  
  206. >gi|2765641|emb|Z78516.1|CPZ78516 C.passerinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  207. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTATAATATATGATCGAGTG
  208. AATCCGGAGGACTTGTGGTTACTCGGCTCGTCCAAGTCTTAGCTTTTGTGGCCCTGATTTGTCGTTGGGC
  209. ATCCTCAGGAGCTTTTATGGCGGGTTTGAACCTCTATCACGGCGCAGTTTGCGCCAAGTCATATGAAGCA
  210. TCACCGACGAATGACATTATTGTCACCAAAGTCGGATGGGCGGTGTGCTATTGTGCATACCAATAATTTT
  211. TTGATGACTCTCGTCAACGGATATCTTAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAAC
  212. CATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGT
  213. GCTGCATCTCTTTTGCCAATGCTTGCCCGACATACAATTAGGCCAGTATTGCATAGATATGAAAGATTGA
  214. CCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGATGTCCCGAACCCCGGCAGGAGGTGGA
  215. GCATGTTGATAGTCGCAAGACTATCGTTCAAATCCCACATGTTGTCGTATTTGTCGGACCCACAGAAGAA
  216. CCTATTTGAACCCCAATGGAGGCAAAACAACCCTCGAGTGATTGATTGCCATTCAGATATGACCCCAGGT
  217. CAGGCGGGGCCACCCGCTGAGTTTAA
  218.  
  219. >gi|2765640|emb|Z78515.1|MXZ78515 M.xerophyticum 5.8S rRNA gene and ITS1 and ITS2 DNA
  220. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTGAGACCGTAGAATAAACGATCGAGTT
  221. AATCTGGAGGACCGGTGTACTTCGATCTCCCAGGGGCTTTCGCTACTGTGGTGGCCTTTGATCTGCCATC
  222. GGGCCTCCTTGGGAGTGTTCTTGAAGGCGATCAAACTTCTAGCCCGGCGCAGCTTCGCGCCAAGTCTTTT
  223. GAGACAAGAATCGGCATAGGGGTGTTCCCTTGTAGCCGGTGGGGGTGGCACTTGATTCGTGCCCCCCAAG
  224. TTACATTTTTACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGA
  225. TAAGTGGTGTGAATTGCAGAATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCTCGAGGCCGTCAG
  226. GCTAAGGGCACGCCTGCCTGGGCGTTGTGTACTGTGTCTCTCCCACCAATGGTTGTCCAAGAATACCGTT
  227. CGGTCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTTCAATGGGTCTAAGACCTCGGGCTTTTGAT
  228. GGTCCAAAATTCGACAAGAGGTGGATGGGCAATGGCTGAGCCAAAGCTGTTGTGCGAATGCCGTATGTTG
  229. TCCGATTTGATGGGCCATCATAATTCGTAGGACCCTTCGGAACCCCATTGGTGCCACATCAACCCAACCC
  230. ATGGGCGGTTGATTGCCATTTGGAAGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGC
  231.  
  232. >gi|2765639|emb|Z78514.1|PSZ78514 P.schlimii 5.8S rRNA gene and ITS1 and ITS2 DNA
  233. CGTAACAAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAAGCCCCCAAATATACGATCGAGAT
  234. AATCCGGAGGACCGGTGTACTTTGGTCTCCCAGGGGCTTCCGCCGCTGTGGTGACCATGATTTCCCATCG
  235. AACCTCCTTGGGAGAGTTCTCTATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCTCCAAGTCAAATG
  236. AGATAGAACCGACAAGGGTCTTCGTCCTCCATGGATGGACCGGGGAGGGCCGGCGTGCTGCTGTGCCCCC
  237. TTAAGATTCGTCTGACAACTCTCGTCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAAT
  238. GTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCC
  239. ATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCAATGCTAAGGTTGAACAGCCA
  240. TACTGTTCGGCCGGCGAGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACTTGGGCT
  241. TGTGACGGTCCACAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTTGTGCGAATGCCC
  242. TATGTTGTCGTATTTGATGGGCCGGAATGATCCCTTTCGAACCCCGTCGGAGGCACGTCGACCCAACCCA
  243. TGGGCGGTTGACGGCCATTAGGATGCAACCCCAGGTCAGGTGAGACTACCCGCTA
  244.  
  245. >gi|2765638|emb|Z78513.1|PBZ78513 P.besseae 5.8S rRNA gene and ITS1 and ITS2 DNA
  246. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATACACGATCGAGTT
  247. AATCCGGAGGACCGGTGTACTTTGGTCTCCCAGGGGCTTCCGCCGCTGTGGTGACCATGATTTGCCATCG
  248. AGCCTCATTGGGAGATTTCTCCATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCAAATG
  249. AGATAGAACCGGCAAGGGCATCGTCCTCCATGGAGCCGGGGAGGCCGGCATGCTGCTGTGCCCGAAAGAA
  250. TTTTCGACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGATAAG
  251. TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCT
  252. AAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCAATGCTAAGGTTGAACAGCCATACTGTTC
  253. GGCCGGCGAGGATGAGAGTTTGGCCCCTTGTTCTTCTGTGCGATGGGTCCAAGACTTGGGCTTGTGACGG
  254. TCCACAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTTTTGTGCGAATGCCCTATGTTGT
  255. CGTATTTGATGTGCCAGAACGATCCCTTTCGAACCCCTTCGGAGGCACGTCGACCCAACCCATGGGCGGT
  256. GACGCCATTAGGATGCAACCCAGTCAGTGAGCTACCGCTGAG
  257.  
  258. >gi|2765637|emb|Z78512.1|PWZ78512 P.wallisii 5.8S rRNA gene and ITS1 and ITS2 DNA
  259. CGTAACAAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAAGCCCCCAAAAAAACGATCGAATT
  260. AATCCGGAGGGCCGGTGTAGTTTGGTCTCCCAGGGGCCTTGGCTACTGTGGTGACCGTGAATTTCCGTCG
  261. AACCCTCTGGGAGGAATTCTTGATGGCAAATGAAACCCTTGGCCCGGCGCAGTTTCGCCCCAAATCAAAT
  262. GAGATGGAACCGGCGGAGGGCATCGTCCCCCATGGAACCGGGGAGGGCCGGCGTTCTTCCGTTCCCCCAA
  263. TGAAATTATTTTTTGACAACTCTCGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAAT
  264. GTGATAAGCTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGC
  265. CATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACAG
  266. GCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGG
  267. GCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATGC
  268. CCTGCGTTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCGTG
  269. GGCGGTCGACGGTCATTTGGATCCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGC
  270.  
  271. >gi|2765636|emb|Z78511.1|PEZ78511 P.exstaminodium 5.8S rRNA gene and ITS1 and ITS2 DNA
  272. CGTAACAAGGTTTCCGTAGGTGAACCTTCGGAAGGATCATTGTTGAGACCCCCAAAAAAACGATCGAGTT
  273. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGCTACTGTGGTGGCCGTGAATTTCCGTCG
  274. AACCTCCTTGGGAGAATTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCCCCAAGTCAAATG
  275. AGATGGAACCGGCGGAGGGCATCGTCCTCCATGGAACCGGGGAGGGCCGGCGTTCTTCCGTTCCCCCCAT
  276. GAATTTTTTTTTGACAACTCTCGGCAACGGATATCTCGGCTCTTTGCATCCGATGAAAGAACCCAGCGAA
  277. ATGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGG
  278. CCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACA
  279. GGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTG
  280. GGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATG
  281. CCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAGCCCCATTGGAGGCACGTCAACCCGT
  282. GGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGA
  283.  
  284. >gi|2765635|emb|Z78510.1|PCZ78510 P.caricinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  285. CTAACCAGGGTTCCGAGGTGACCTTCGGGAGGATTCCTTTTTAAGCCCCCGAAAAAACGATCGAATTAAA
  286. CCGGAGGACCGGTTTAATTTGGTCTCCCCAGGGGCTTTCCCCCCTTGGTGGCCGTGAATTTCCATCGAAC
  287. CCCCCTGGGAGAATTCTTGGTGGCCAATGGACCCTTGGCCCGGCGCAATTTCCCCCCCAATCAAATGAGA
  288. TAGGACCGGCAGGGGGCGTCCCCCCCCATGGAACCGGGGAGGGCCGGCATTCTTCCGTTCCCCCCTCGGA
  289. TTTTTTGACAACTCTCGCAACGGATATCTCGCCTCTTTGCATCGGATGGAAGAACGCAGCGAAATGTGAT
  290. AAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAG
  291. GCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTG
  292. TTCGGCCGGCGCGGATGAGAGATTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGA
  293. CGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTGCGTT
  294. GTCGTTTTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTG
  295. ACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGCCACCCGCTGAGTTTA
  296.  
  297. >gi|2765634|emb|Z78509.1|PPZ78509 P.pearcei 5.8S rRNA gene and ITS1 and ITS2 DNA
  298. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  299. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGACCGTGATTTGCCATCG
  300. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  301. AGATAGAACCGGCGGAGGGCGTCGTCCTCCATGGAGCGGGGAGGGCCGGCATGCTCCGTGCCCCCCCATG
  302. AATTTTTCTGACAACTCTCGGCAACGGACGTAACAAGGTTTAAATGTGATAAGCAGGTGTGAATTGCAGA
  303. ATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGTTAAGGGCACGCCTGCCT
  304. GGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTGTTCGGCCGGCGCGGATGAG
  305. AGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTCCAAAATCCGGCAAG
  306. AGGTGGACGGACGGTGGCTGCGACAGAGCTGTCGTGCGAATGCCCTACGTTGTCGTTTTTGATGGGCCAG
  307. AATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCAATGGGGGGTGACGGGCATTTGGTTAACCC
  308. CGGCAAGTTAAGGCACCCGTTAATTTTAGGA
  309.  
  310. >gi|2765633|emb|Z78508.1|PLZ78508 P.longifolium 5.8S rRNA gene and ITS1 and ITS2 DNA
  311. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  312. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGACCGTGATTTGCCATCG
  313. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  314. AGATAGAACCGGCAGGGGGCGTCGTCCTCCATGGAGCCGGGGAGGGCCGGCATGCTGCCGTGCCCCCAAT
  315. GAATTTTTTGACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGA
  316. TAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCA
  317. GGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACT
  318. GTTCGGCCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTG
  319. ACGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAGAGCTGTCGTGCGAATGCCCTACGT
  320. TGTCGTATTTGATGGGCCGGAATAAATCCCTTTGAACCCCATTGGAGGCACGTCAACCCCATGGGCGGTG
  321. ACGGCCACTTGGATGCAACCCAGTCAGTGAGCCACCGCTGA
  322.  
  323. >gi|2765632|emb|Z78507.1|PLZ78507 P.lindenii 5.8S rRNA gene and ITS1 and ITS2 DNA
  324. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCCCCAAAAAAACGATCGAGTT
  325. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGCTACTGTGGTGACCGTGAATTTCCGTCG
  326. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCCCCAAGTCAAATG
  327. AGATGGAACCGGCGGAGGGCATCGTCCTCCATGGAACCGGGGAGGGCCGGCGTGCTTCCGTCCCCCAATG
  328. AATTTTTTTGACAACTCTCGCAACGGATATCTCGCTCTTGCATCGATGAAGAACACAGCGAAATGTGATA
  329. AGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGG
  330. CTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACAGGCATACT
  331. GTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTG
  332. ACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATGCCCTGCGT
  333. TGTCGTATTTGATGGGCCGGAATAAATCCCTTTGAACCCCATTGGAGGCACGTCAACCCGTGGCGGTCGA
  334. CGGCCATTTGGATGCAACCCAGTCAGTGAGCCACCGCTGA
  335.  
  336. >gi|2765631|emb|Z78506.1|PLZ78506 P.lindleyanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  337. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  338. AATCCGGAGGACTGGTGTAGTTTGGTCTCCCAGGGGCGTTGGCTACTGCGGTGACCATGATTTTCCATCG
  339. AGCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATG
  340. AGATAGAACCGGCAGAGGGCTTCGTCCTCCATGGAACCGGGGAGGACCGGCATGCCGCCGTACCCCCTTT
  341. GAATCGGGCTGACAACTCTCGTTCAAGGAGCCCTCAGCTCATAATGTGATAAGTGGTGTGAATTGCAGAA
  342. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTG
  343. GGCGTTGCGTGCTGCATCTCTCCCGTTGCTAAGGTCGAACAGGCATATACTGTTCGGCCGGCGCGGATGA
  344. GAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTAAAAAATCCGGCAA
  345. GAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTACGTTGTCGTATTTGATGGGCCA
  346. GAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTTGACGGCCATTGGATGCCA
  347. ACCCAGTCAGGTGAGGCCACCCGCTGA
  348.  
  349. >gi|2765630|emb|Z78505.1|PSZ78505 P.sargentianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  350. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  351. AATCCGGAGGACTGGTGTAGTTTGGTCTCCCAGGGGCGGTGGCTACTGCGGTGACCATGATATTCCATCG
  352. AGCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCGTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATG
  353. AGATAGAACCGGCAGAGGTCTTCGTCCTCCATGGAACCGGGGAGGCCCGGCATACCACCATACCCCCAAT
  354. GAATCTTTGTGACAACTCTCGTCAATGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTC
  355. TTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCT
  356. CTCCCGTTGCTAAGGTCGAACAGGCATACTGTTCGGTCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTC
  357. GGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTAAAAAATCCGGCAAGAGGTGGACGGACGGTGGCTG
  358. CGACAAAGCTGTCGTGCGAATGCCCTGCGTTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCC
  359. CATTGGAGGCACGTCAACCCATGGGCGGTTGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGCCACC
  360. CGCTGAGTTTT
  361.  
  362. >gi|2765629|emb|Z78504.1|PKZ78504 P.kaiteurum 5.8S rRNA gene and ITS1 and ITS2 DNA
  363. CGTAACAAGGTTTCCGTAGGTGAACCTTCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  364. AATCCGGAGGACTGGTGTAGTTTGTCTCCCAGGGGCGTTGGCTACTGCGGTGACCATGATTTTCCATCGA
  365. GCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATGA
  366. GATAGAACCGTCAGAGGGCATCGTCCCTCCATGGAGCCGGGGAGGGCCGGCATGCCCGCCGTGCCCCCAA
  367. TGAATCTTTTTGACAACTCTCGCAACGGATATCTCGCTCTTCATCGATGAAGAACGCAGCGAAATGTGAT
  368. AAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGCCATCAGG
  369. CTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCGTTGCTAAGGTCGAACAGACATACTGT
  370. TCGGCCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGAC
  371. GGTACCAAATCCGACAAGAGGTGGACGGACGGTGGCTGCGACAAAACTGTCGTGCGAATGCCCTACGTTG
  372. TCGTATTTGATGGGCCAGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTGAC
  373. GGCCATTGGATGCAACCCCAGTCAGTGAGCCACCGCTGAGTAA
  374.  
  375. >gi|2765628|emb|Z78503.1|PCZ78503 P.czerwiakowianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  376. CGTAACCAGGTTTCCGTAGGTGAACCTCCGGAAGGATCCTTGTTGAGACCGCCAAATATACGATCGAGTT
  377. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGTCCGTGATTTACCATCG
  378. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCATGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  379. AGATAGAACCGGCAGGGGGCGTCGTCCTCCATGGAACCGGGGAGGGCCGGCATGCTACCGTACCCCCAAT
  380. GAATTATTTTGACAACTCTCGGCAACGGAGTCTCAGCTCTTTGTGATAAGTGGTGTGAATTGCAGAATCC
  381. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGC
  382. GTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTGTTCGGCCGGCGCGGACGAGAGTT
  383. TGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTCCAAAATCCGGCAAGAGGT
  384. GGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTACGTTGTCGTATTTGATGGGCCAGAATA
  385. AATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTGACGGCCATTTGGATGCAACCCCA
  386. GGTCAGGTGAGCCACCCGCTGAGATAA
  387.  
  388. >gi|2765627|emb|Z78502.1|PBZ78502 P.boissierianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  389. CGTAACCAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  390. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCCCTGTGGTGACCGTGATTTGCCATCG
  391. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCATGACCCGGCGCAGTTTCGCGCCAAGTCATATG
  392. AGATAGAACCGGCAGGGGTCGTCGTCCTCCATGGAGCCGGGGAGGGCCGGCATACTACCGTCCCCCCAAT
  393. GAATTTTATATTGACAACTCTCGGCCGGAATCTCGGCTCTTGCATCGATGGAAGGACGCAGCGAAAATGT
  394. GATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT
  395. CAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCGTA
  396. CTGTTCGGCCGGCGCGGACGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTT
  397. TGACGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTAC
  398. GTTGTCGTATTTGATGGGCCAGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGG
  399. TTGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCCGTGAGTTTACGC
  400.  
  401. >gi|2765626|emb|Z78501.1|PCZ78501 P.caudatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  402. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  403. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGTTACTGTGGTGACCGTGACTTTGCCGTC
  404. GAGCCTCCTTGGGAGATTTCTTGATGGAAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATAT
  405. GAGATGGAACCGGCGGAGGGAATCGTCCTCCATGGAGCCGGGGAGGGCCGGCGTGTTGCCGTGCCCCCAA
  406. TGAATTTTTTTTTGGGCAACTCTCGGCCAAACGGGAAATCTCGGCTCCTTGCATCGGATGGAAGGACGCA
  407. GCGAAATTGTGATAAGTGTTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCG
  408. CCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGG
  409. CTGAACAGGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCA
  410. AGACCTGGGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGA
  411. GCGAATGCCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTC
  412. AACCCGTGGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGA
  413.  
  414. >gi|2765625|emb|Z78500.1|PWZ78500 P.warszewiczianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  415. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGCTCATTGTTGAGACCGCAAAATAATTGATCGAGTT
  416. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGTTACTGTGGTGACCGTGACTTTGCCGTC
  417. GAGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATAT
  418. GAGATGGAACCGGCGGAGGGCATCGCCCTCCATGGAGCCGGGGAGGGCCGGCGTCCTGCCGTGCCCCCAA
  419. TGAATTTTTCTTTGGGAAAACTTCTCGGCCAACGGGAATCTCGGCTCTTTGCATCGGATGGAAGGACGCA
  420. GCGAATTGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC
  421. CGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCT
  422. GAACAGGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAG
  423. ACCTGGGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGC
  424. GAATGCCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAA
  425. CCCGTGGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAG
  426.  
  427. >gi|2765624|emb|Z78499.1|PMZ78499 P.micranthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  428. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAGGGATCATTGTTGAGATCGCATAATAATTGATCGAGAT
  429. AATCCAGAGGATCGGTTTACTTTGGTCACCCTTGGGCGCCTGCTATTGCGGTGACCTAGATTTTCCATGG
  430. AGGGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGTCGCAGTTTTGCACCAAGTCAT
  431. ATGACACATAAATGGTGAAGGACATACCCCCTTCGTTGAATTCGAGGAGGGGACGGCATGTGGCCTTGAC
  432. CTCTCCCAATTATTTTTTTGACAACTCTCAGCCAACGGATATCTCGGCTCTTTGCATCGGATGGAGGACG
  433. CAGCGAAATGCGATAAGTGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGC
  434. CCAAGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTC
  435. CATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGCCCCCTTGTTCTTTGGTGCTGGGGGTCTAAGAGC
  436. TGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCATGCTACAACAAAACTGTTGGGC
  437. GAATGCTCCAGGTTGTCGTATTAGATGGGCCATCATAATCTAGAGACCCTTGTGAACCCCATTGGAGGCC
  438. CATCAACCCATGATCAGTTGATGGCCTTTTGGATGCGACCCCAGGTCAGGTGAGCAACC
  439.  
  440. >gi|2765623|emb|Z78498.1|PMZ78498 P.malipoense 5.8S rRNA gene and ITS1 and ITS2 DNA
  441. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAAGGTCATTGTTGAGATCACATAATAATTGATCGAGTT
  442. ACTCCAGAGGATCAGTTTACTCCGGTCACCCATGGGTGCTTGCTATTGCGGTGACCTAGATTTGCCATGG
  443. AGCCTCCTTGGGAGTTTTCTTGCCGGCGATCTTACCCTTGCCCGGGGCAGTTTTGCCCCAAGTCATATGA
  444. CACAATAATGGCGAAGGAGGGGGCGGCATTTTGCCCTTGACCCTACAATCACTCCCCCTCTCCAAATTAT
  445. TTTTGGACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAATGCGATAAG
  446. TGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCC
  447. AAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTACATGCATACTGTTCA
  448. GCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTGCTGGGGGTCTAAGAGCTGCAGGGGCTTTTGA
  449. TGGTCCTAAATTCGGCAAGAGGTGGACGAATTACAACAAAACTGTTGTGCGAATGCTCCAGGTTGTCGTA
  450. TTAGATGGGCCAGCATAATCTAAAGACCCTTGTGAACCCCACTGGAGGCACATCAACCCGTGATCAGTTG
  451. ATGGCCATTTGTTGCGACCCCAGTCAGTGAGCAACCCGCTGAGTTTAAGC
  452.  
  453. >gi|2765622|emb|Z78497.1|PDZ78497 P.delenatii 5.8S rRNA gene and ITS1 and ITS2 DNA
  454. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTG
  455. AATCCAGAGGATCAGTTTACTTTGGTCGCCCATGGGCGCTTGCTATTGCGGTGACCTAGATTTGCCATGG
  456. AGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCACATGA
  457. CACATAAATGGTGAAGGGCACGGCCCTTTGTGAATTCAAGGAGGTGAAGGGCATGTGGCCTTGAGCCTAC
  458. ACTCCCTCCCCCTCTCCAAATTATTTTTTGTGAAACAACTCTCAGCAACGGAGATCTCAGCTCTTGCATC
  459. GATGAAGGAACGCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGA
  460. ACGCAAGTTGCGCCCAAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCC
  461. TTAACGAGGCTGTCCAGGCATACTGTTCAGCCGGTGCGGGTGTGAGTTTGGCCCCTTGTTCTTTGGTGCT
  462. GGGGGTCTAAGAGCTGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGCAACGCGCTACAA
  463. CAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAACACCCTTGTGAA
  464. CCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGC
  465. AACCCGCTGAGTTTAAGC
  466.  
  467. >gi|2765621|emb|Z78496.1|PAZ78496 P.armeniacum 5.8S rRNA gene and ITS1 and ITS2 DNA
  468. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  469. AATCCAGAGGATCGGTTTACTTTGGTCACCCTTGGGCGCCTGCTATTGCGGTGACCTAGATTTGCCATGG
  470. AGGGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAT
  471. ATGACACATAATTGGTGAAGGGCATATCCCTTCGTGAATTCGAGGAGGGGCCGGCATGTGGCCTTGACCT
  472. CTCCAATTAATTTTTTGAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGGAGGGACGCACC
  473. GAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCGCCC
  474. AAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCC
  475. ATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTGCTGGGGGTCTAAGAGCT
  476. GCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCATGCTACAACAAAACTGTTGGGCG
  477. AATGCTCCAGGTTGTCGTATTAGATGGGCCATCATAATCTAGAGACCCTTGTGAACCCCATTGGAGGCCC
  478. ATCAACCCATGATCAGTTGATGGCCTTTTGGGTTGCGACCCCAGGTCAGGTGAGGCAACCAGCTGAGTTT
  479. AAGC
  480.  
  481. >gi|2765620|emb|Z78495.1|PEZ78495 P.emersonii 5.8S rRNA gene and ITS1 and ITS2 DNA
  482. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  483. AATCCAGAGGATCGGTTTACTTTGGTCACCCATGGGCGCTTGCTATTGCGGTGACCTAGAGTTGCCATGG
  484. AGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGTCCGGCGCGGTTTTGCGCCAAGTCATAT
  485. GACACATAATTGGTGAAGGGCATAGCCCTTCGTGTATTCAAGGAGGGGGGGCGGCATGTGGCCTTGACAC
  486. TGCACTCGCTCTCCCCCTCTCCAAAGTATTTTTCTGAACAACTCTCAGCAACGGATATCTCAGCTCTTGC
  487. ATCGGATGGAGGAACGCAGCGAAATCCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCT
  488. TTTGAACGCAAGTTGCGCCCGAGGCCATGAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATCTCT
  489. CTCCCTCAATGAGGCTGTCCATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTG
  490. GTGCTGGGGGTCTAAGAGCAGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCAGGC
  491. TACAACAACACTGTTGTTGTGCGAATGCTCCAGGTTGTCGTATTAGATGGGCCGGCATAATCCAGAGACC
  492. CTTGTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTCGGTTGCGACCCCAGGTCA
  493. GTGAGCAACCCGCTGAGTG
  494.  
  495. >gi|2765619|emb|Z78494.1|PNZ78494 P.niveum 5.8S rRNA gene and ITS1 and ITS2 DNA
  496. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGGTCGCATAATAATTGATCGAGTT
  497. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGACATTTACTGTTGCAGTGACCTAGATTTACCATCG
  498. GGCCTCCTTGGGAACTTTCCTGCTGGCGATCTATACCCTTGCCCGGCGCAGTAATGCGCCAAATCAAATG
  499. ACCCATAATTAATGAAGGGGGACGGCATACTGCCTTGACCAACTCCCCATTATTGAGGTAACACTCTCAA
  500. CTTCGGATATCTCAGGTGTGAATTGCAGAATCCCGTTAACATCGAGTCTTTGAACGCAAGTTGGGCCCGA
  501. GGCCAACAGGCCAAGGGAACGCCTGTCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCAT
  502. ACGTACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCTGC
  503. ATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAA
  504. TGCCCCGGGTTGTTGTGTTTAATCAGAAGACCCTTTTGAACCCCATTGGAGGCCCATCGACCCATGATCA
  505. GTTGAATGGCCATTTGGTTGCGATCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAAG
  506.  
  507. >gi|2765618|emb|Z78493.1|PGZ78493 P.godefroyae 5.8S rRNA gene and ITS1 and ITS2 DNA
  508. CGTAACAAGGATTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  509. AATCTGGAGGATCGGTTTACTTTGGTCACCCATGGGCATTTTCTGTTGCAGTGACCTAGAATTTCCATCG
  510. GGCCTCCCTGGGAGCTTTCCTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAAATT
  511. TTACATAAGTGGTGAAGGGGGGCGGCATTCTTCCTTGACCAGCCCCCAAGTATTTAGGTAACAACTCTCA
  512. GCAACGGATATCTCGGCTCATGCATCGATGAAGGAACGCAGCGAGATTCGATAAATGGTGTGCCTTGCAG
  513. AATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCGCGAGGCCATCAGCCCAAGGGGACGCCTGCC
  514. TGGACATTGCGACTCATATCTCTCCCTTAATGAGGCTGTCCAAACGTACTGGTCATCCGGTGTGGATGTG
  515. AGTTTGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  516. CAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTTGTGTTTAATCAGA
  517. AGACCCTTTTGAACCCCATTGGAGGCCCATCGACCCATGATCAGTTGAATGGCCATTTGGTTGCGATCCC
  518. AGGTCAGGTGAGGCAACCC
  519.  
  520. >gi|2765617|emb|Z78492.1|PBZ78492 P.bellatulum 5.8S rRNA gene and ITS1 and ITS2 DNA
  521. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  522. AATCTGGAGGATCAGTTTACTTTGGTCACCCACGGGCATTTGCTGTTGCAGTGACCTAGAATTTGCCATC
  523. GAGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATAT
  524. GTCACATAATTGGTGAAGGGGGGGAGCGTACTGCCTTGACCCACTCCAAATTATTTTTTTAACAACTCTC
  525. AGCAACGGATATCTCGGCTCTTGCATCGATGTAGAACCCAGCGAAATGCGATACTGGTGTGATTTGCAGA
  526. ATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCT
  527. GGGCATTGCGAGTCAAATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGA
  528. GTTTGGCCCCTTGTTCTTTGGGACGGGGGGTCTAAGAGCTGCACGGGCTTTTGATGGTCCTAAATACGGC
  529. AAGAGGTGGACGAATTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTTGTGTTACATGGGCC
  530. AGCTTAATCAGAAGACCCTTTTGGACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATTGGCCATTT
  531. GGTTGCGATCCCAGTCAGGTGAGGCACACCGCTGAGTTTAATA
  532.  
  533. >gi|2765616|emb|Z78491.1|PCZ78491 P.concolor 5.8S rRNA gene and ITS1 and ITS2 DNA
  534. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  535. AATCTGGAGGATCAGTTTACTTTGGTCACCCACGGGCATTTGCTGTTGCAGTGACCTAGATTTGCCATCG
  536. GGCCTCCTTAGGAGCTTTCTTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  537. ACACATAATTGGTGTTGGGGGGAGGCGTGCTGCCTTGACCCGCTCCAAATTATATTTTTAACAACTCTCA
  538. GCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCAGCGAAATGCGATAAATGGTGTGAATTGCAGAA
  539. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTG
  540. GGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAG
  541. TTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCA
  542. AGAGGTGGACGAACTATGCTACAACAAAATGTTGTGCGAATGCCCCGGGTTGTTGTGTTACATGGACCAG
  543. CATAATCAGAAGACCCTTTGGACCCCATTAGAGGCCCATCAACCCATGATCAGTTGAATGGCCATTTGTT
  544. GCGATCCCAGTCAGGTGAGCAACCCGCTGAGATAAGC
  545.  
  546. >gi|2765615|emb|Z78490.1|PFZ78490 P.fairrieanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  547. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  548. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGACCGAGATTTGCCATCG
  549. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTGAACCCTAGTCCGGCGCAGTTTTGCGCCAAGTCATATG
  550. GCACATAATTGGTGAAGGGGGCGGCATGCTGCCTCGACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  551. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  552. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  553. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCAAACATACTGTTCAGCCGGTGCGGATGTGAGT
  554. TTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAACGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAA
  555. GAGGTGGACGACTGTTCTGCAACAAGTGTTGTGCGAATGCCCCGCGTTGTCGTATTAGATGGGCCAGCAT
  556. AATTTGAAGACCCTTTTGAACCCCATTGGAGGCCCGTCAACCCATGATCAGTTGACGGCCATTTGGTTGC
  557. GACCCCAGTCAGGTGAGCAACCAGCTGA
  558.  
  559. >gi|2765614|emb|Z78489.1|PDZ78489 P.druryi 5.8S rRNA gene and ITS1 and ITS2 DNA
  560. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  561. AATCTGGAGGATCAGTTTACTTTGGTCACCCGAGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  562. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCGAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  563. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAGATTATTTTTTAACAACTCTCAGC
  564. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  565. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  566. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGGGGATGTGGGT
  567. TTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCATGGGATTTTGATGGTCCTAAATACGGCAA
  568. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGAGTTGTCGTATTAGATGGGCCCA
  569. GCATATCTGAAGACCCTTTTGAACCCCATGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTT
  570. GCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGGC
  571.  
  572. >gi|2765613|emb|Z78488.1|PTZ78488 P.tigrinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  573. CTGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACGCAATAATTGATCGAGTTAATCTGGAGGATC
  574. AGTTTACTTTGGTCACCCATGGGCATTTGTTATTGCAGTGACCGAGATTTGCCATCGAGCCTCCTTGGGA
  575. GCTTTCTTGCTGGCGATCTTAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATACGACACATAATTGGT
  576. GAAGGGGGCGGCATGGTGCCTTGACCCTCCCCTAATTATTTTCTAACAACTCTCATCAACGGGATGGAGA
  577. ACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACCCAAGTT
  578. GCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCAAATCTCTCCCTTAATGAGG
  579. CTGTCCATACATACTGTTCAACCGGTGCGGATGTGAGTTTGCCCCCTTGTTCATTGGTACGGGGGGTCTA
  580. AGAGCTGCATGGGCTTTTGATGGTCCTAAAAACGGCAAGAGGTGGACGAACAACGCCACAACCAAACTGT
  581. TGTGCGGATCCCCCGGGTTGTCGTATTAGATGGGCCATCATAATCTGAAGACCCTTTTGAACCCCATCGG
  582. AGGCCCATCAACCCATGATCAGTTGATGGACATTTGTTGCGACCCCAGTCAGGTGAGCAACCGGCT
  583.  
  584. >gi|2765612|emb|Z78487.1|PHZ78487 P.hirsutissimum 5.8S rRNA gene and ITS1 and ITS2 DNA
  585. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  586. ACTCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGGGATTTGCCATCG
  587. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  588. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTTACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  589. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  590. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  591. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATATTGTTCAGCCGGTGCGGATGTGAGT
  592. TCGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCAGCATGGGCTATCGATGGTCCTAAATGCGGCAA
  593. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  594. CGTAATCTAAAGACCCTTTTGAACCCCATTAGAGGCCCATCAACCCATGATCAGTTGGGGCCACTTGTTG
  595. CGACCCCAGTCAGGTGAGCAACCGCTGAGTAA
  596.  
  597. >gi|2765611|emb|Z78486.1|PBZ78486 P.barbigerum 5.8S rRNA gene and ITS1 and ITS2 DNA
  598. CGTCACGAGGTTTCCGTAGGTGAATCTGCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  599. TATCTGGAGGATCAGTTTACTTTGGTCACCCATGGACATTTGCTATTGCAGTGCCCGAGATTTGCCATCG
  600. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  601. ACACATAATTGGTGAAGGGTGCGGCATGGTGCCTGACCCTCCCCAAATTATTTCTTAACAACTCTCAGCA
  602. ACGGATATCTCGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  603. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  604. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTT
  605. GGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGGCAAGA
  606. GGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCA
  607. TAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTAG
  608. CGACCCCAGGTCAGGTGAGGCAACCCGCTGA
  609.  
  610. >gi|2765610|emb|Z78485.1|PHZ78485 P.henryanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  611. CTGAACCTGGTGTCCGAAGGTGAATCTGCGGATGGATCATTGTTGAGATATCATAATAATTGATCGAGTT
  612. AATCTGGAGGATCAGTTTACTTTGGTCACCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCGA
  613. GCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGGGCAGTTTTGCGCCAAGTCATATGA
  614. CACATAATTGGTGAAGGGTGCGGCATGGTGCCTTGACCCTCCCCAAATTATTTCTTAACAACTCTCAGCA
  615. ACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATC
  616. CCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGG
  617. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTGCAGCCGGTGCGGATGTGAGTT
  618. TGGGCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGCCAAG
  619. AGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGACGGGCCAGC
  620. ACAATCTAAAGACCCCTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATGTGTTG
  621. CGACCCCAGTCAGCTGAGCAACCCCTGATTTAGTA
  622.  
  623. >gi|2765609|emb|Z78484.1|PCZ78484 P.charlesworthii 5.8S rRNA gene and ITS1 and ITS2 DNA
  624. CGTAACAAGGTTTCCGTAGGTGAACCTGGGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  625. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGGCTATTGCAGTGACCGAGAGTTTACCAT
  626. CGAGCCTCCATGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGGCCCAAGTCATA
  627. TGACACATAATTGTGAAGGGGCGGCATGTTTCCTACCCTCCCAACTCTCAGCAACGGATATCTCGCTCTT
  628. GCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCT
  629. TGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTC
  630. TCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGG
  631. TACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCT
  632. ACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTT
  633. GACACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGTCCATTGGGTTGCGACCCCAAGTCAGGT
  634. GAAGCAACTCCCTGAGTTTT
  635.  
  636. >gi|2765608|emb|Z78483.1|PVZ78483 P.villosum 5.8S rRNA gene and ITS1 and ITS2 DNA
  637. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  638. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  639. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  640. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCCAAATTATTTTTTAACAACTCTCAG
  641. CAACGGAAATCTGGCCTCTTGCATGGATGAAGACCAAACCGAAATCATAAATGGTGTGAATTGCAGAATC
  642. CCGTGAACAATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGG
  643. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCACACATATCTGTTCAGCCGGTGCGGATGTGAGT
  644. TTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGTTGGTCCTAAATACGGCAA
  645. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  646. CATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGT
  647. TGCGACCCCAGGTCAAGTGAAGCAACCCCTGAGTTTAGCA
  648.  
  649. >gi|2765607|emb|Z78482.1|PEZ78482 P.exul 5.8S rRNA gene and ITS1 and ITS2 DNA
  650. TCTACTGCAGTGACCGAGATTTGCCATCGAGCCTCCTGGGAGCTTTCTTGCTGGCGATCTAAACCGTAGC
  651. CCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTC
  652. CCCAAATTATTTTTTAACAACTCTCNGCAACGGATATCTCGCCTCTTCATCGATGAAGAACGCAGCGAAA
  653. TGCGATAAATGGTGTGAATTGCAGAATCCCGTGAANCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGG
  654. CCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATAC
  655. ATACTGTTCAGCCGGTGCGGATGTGCGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGT
  656. GGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATG
  657. CCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCA
  658. ACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  659.  
  660. >gi|2765606|emb|Z78481.1|PIZ78481 P.insigne 5.8S rRNA gene and ITS1 and ITS2 DNA
  661. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  662. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  663. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  664. ACACATAATTGGCGAAGGGGGCGGCATGGTGCCTTGACCCTCCCCAAATCATTTTTTTAACAACTCTCAG
  665. CAACGGAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCACACATAC
  666. TGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGC
  667. TTTTGTTGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCC
  668. GGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCC
  669. ATGATCAGTTGA
  670.  
  671. >gi|2765605|emb|Z78480.1|PGZ78480 P.gratrixianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  672. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  673. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  674. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  675. ACACATAATTGGCGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  676. AACGGATAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTCAATGAG
  677. GCTGTCCACACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCT
  678. AAGAGCTGCGTGGGCTTTTGTTGGTACCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAAAT
  679. GTTGTGCGAATGCCCCGGGTTGTCGTATAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTG
  680. GAGGCCCATCAACCCATGATCAGTTGA
  681.  
  682. >gi|2765604|emb|Z78479.1|PPZ78479 P.primulinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  683. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  684. AATCAGGAGGATCAGGTTACTTTGGTCACCCATGGGCATTTGCTGTTTCAGTGACCTAGATTTGCCATCG
  685. AGCCGAACTAAACCCTTGCCCGGCGCAGATTTGCGCCAATTTATATGAGACATTACTGGAAGGGGAGGGA
  686. TGCTGCCTTGCCTTGCCCCCCAAATTATTTTTTAACAACTCTCAGCAACGGATATCTCGCCTCTTGCATC
  687. GATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATACAGAGATCCCGTGAACCATCGAGTCTTGAAC
  688. GCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCTT
  689. AATGAGGCTGTCGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGA
  690. GCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCGACAACAGAACTGTTGT
  691. GCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGG
  692. CCCATCAACCCAAGATCAGTTGACGGCCATTTGGATGCGACCCCAGGTCAGGTGAGGCAACCCTCTGAGT
  693.  
  694. >gi|2765603|emb|Z78478.1|PVZ78478 P.victoria 5.8S rRNA gene and ITS1 and ITS2 DNA
  695. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCAGTGTTGAGATCACATAATAATTGATCGAGTT
  696. AATCTGGGGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGGCCTAGAGTTTGCCATC
  697. GAGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAACTGGAAGGGGCGGC
  698. ATGCTGCCATGGCTCCCCCAAATATTGATAATGGCGTGATAGCAGATCCCTGAACATCGAGTTTTGAACG
  699. CATGTTGCGTCCGAGGCCATCAGGTCAAGGGGACGCCTGCCTGGAAATTGTGAGACATATCTCTCCCTTA
  700. ATGAGGCTGCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTCCTTTGGTACGGGGG
  701. TCTAAGAGCTGTATGGGTTGGATGGTCCTAAATACGGCAAGAGGTGGACGAGCTATGTGACAACAGAACT
  702. GTTGTGCGAATGCCCCGGTTGTCGTTTAGATGGGTCAGCATAATCTAAAGACCCTTTTGACCCCCATTGG
  703. AGGCCCATCAACCCATTATCAGTTGAGGACATTTGGTTGCGACCCAGGTCAGATGAGGCACCCGCTGAGT
  704. TTAGGC
  705.  
  706. >gi|2765602|emb|Z78477.1|PVZ78477 P.victoria 5.8S rRNA gene and ITS1 and ITS2 DNA
  707. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATGATAATTGATCGAGTT
  708. AATCTGGAGGATCAGTTTGCTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGACCTAGATTTGCCATCG
  709. AGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGAAGGGGCGGCA
  710. TGCTGCCTTGCCCTCCCCAAATATTTGTTAACCAACTCTCAGCAACGAGTATCTCGGCTCTTGCATCGGA
  711. TGGAAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAAGAATCCCTGAACCATCGAGTCTTTGGAA
  712. CGCAAGTTGCGGCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCT
  713. TAATGAGGCTGTCCACACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGG
  714. GGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCGACAAC
  715. AGAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAAC
  716. CCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGCA
  717. ACCGCTGAGTTTATGC
  718.  
  719. >gi|2765601|emb|Z78476.1|PGZ78476 P.glaucophyllum 5.8S rRNA gene and ITS1 and ITS2 DNA
  720. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATGATAATTGATCGAGTT
  721. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGTAGTGACCTAGATTTGCCATCG
  722. AGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGAAGGGCGGCAT
  723. GCTGCCTTGGCCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTAGGCCAT
  724. CCGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCTTAATGAGGCTGTCCATACATAC
  725. AGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGC
  726. TTTTGATCCACCTAAATACGGCAAGAGGTGGACGAACTATGCGACAACAGAACTGTTGCGCGAATGCCCC
  727. GGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAATCCCATTGGAGGCCCATCAACCC
  728. ATGATCAGTTGACGGCCATTTGGTTGCGACCC
  729.  
  730. >gi|2765600|emb|Z78475.1|PSZ78475 P.supardii 5.8S rRNA gene and ITS1 and ITS2 DNA
  731. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  732. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  733. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCGTCCCGGCGCAGTTTTGCGCCAAGTCATATGA
  734. CACATAATTGGAAGGGGGTGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGCAA
  735. CGGATATCTCGGCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  736. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAGGCCAAGGGCACGCCTGCCTGGG
  737. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAATGCGGATGTGAGTT
  738. TGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCAAAATACGGCAAG
  739. AGGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGC
  740. ATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  741. GCGACCCAGGTCAGGT
  742.  
  743. >gi|2765599|emb|Z78474.1|PKZ78474 P.kolopakingii 5.8S rRNA gene and ITS1 and ITS2 DNA
  744. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACGTAATAATTGATCGAGTT
  745. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTTCAGTGACCTGGATTTGCCATCG
  746. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCCAATCATATG
  747. ACACATAATTGGAAGGGCGGCATCCTGCCTTGACCCTCCCCAAATTATATTTTTGACAACTCTCAGCAAC
  748. GGATATCTCGCCTCTTGCATCGATGAAGACACAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCG
  749. TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
  750. TGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGG
  751. CCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCAAAATACGGCAAGAGG
  752. TGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATA
  753. ATCTACAGACCCTTCTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCG
  754. ACCCCAGGTCAGGTGAAGCAACCCGTTGAGCTT
  755.  
  756. >gi|2765598|emb|Z78473.1|PSZ78473 P.sanderianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  757. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
  758. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  759. AGCCTCCATGGGAGCTTTCTTGGTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  760. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTGTTAACAACTCTCAGCA
  761. ACGGATATCTCGGCTCTTCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATC
  762. TCTCCCTTCAATGAGGCTGTCCATACATACTGTTCAGTCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  763. GCCTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTACCTAAATACGGCAAGAGGTGGACGAACTA
  764. TGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACC
  765. CTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCAGG
  766.  
  767. >gi|2765597|emb|Z78472.1|PLZ78472 P.lowii 5.8S rRNA gene and ITS1 and ITS2 DNA
  768. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  769. AATCTGGAGGATCAGTTTACTTTAGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  770. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATCGTTGCCCGGCGCAGTCTTGCGCCAAGTCATTTC
  771. ACACATAATTGGAAGGGGGCGGCATGCAGTCTAAGACCCTCCCCAAATTATTTTTTGATAACTCTCAGCA
  772. ACGGAATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  773. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  774. ATTGCGAGTCATATCTCTCCTTTAATGAGGCTGTCTATACATACTGTTCAGCCACAGCGGATGTGAGTTT
  775. GGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCTTAAATACGGCAAGA
  776. GGTGGACGAAGTATGCTACAACAAAATTGTAGTTCGAATGCCCAGGGTTGTCGTATTAGATGGGCCAGCA
  777. TAATCTAAAGACCCTTTGAACCCCTTTAGAGGCCAATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
  778. GACCCCAAGTCAGGTGAGGCAACCGCTGAGTTTAAGC
  779.  
  780. >gi|2765596|emb|Z78471.1|PDZ78471 P.dianthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  781. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  782. AATCTAGAGGATCGGTTTACTTTGGTCACCCATGGGCATCTGCTCTTACAGTGACCTGGATTTGCCATCG
  783. AGCCTCCTTGGGAGCTGTCTTGCTGGCGATCTAAATCGTTGCCCGACGCAGCCTTGCGTCAAGTCACCCC
  784. GACACATAATGGAAGGGGGCGGCATGCTGCCTTGACCCTTCCCCAAATTAATTTTTTGACAACTCTCAAC
  785. ATCGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  786. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCTTGG
  787. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAGTGCGGATGTGAGT
  788. TTGGCCCCTTGTTCTTTAGTACGGGGGGTCTAAAAGCTGCATGGGCTTTTGCTGGTCCTAAATACGGCAA
  789. GAGGTGGACAAAGTATGCTACAACAAAATTGTAGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  790. CATAATTTAAAGACCCTTTTGAACCCCATTAGAGGCCCATCAACCCTGATCAGTTGATGGCCATTTGGTT
  791. GCGACCCCAAGTCAGGTGAGGCAACCCGCTGAGTTTAAGC
  792.  
  793. >gi|2765595|emb|Z78470.1|PPZ78470 P.parishii 5.8S rRNA gene and ITS1 and ITS2 DNA
  794. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  795. AATCTAGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTACAGTGACCTGGATTTGCCATCG
  796. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATCGTTGCCCGACGCAGCCTTGCGTCAAGTCATATG
  797. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTTCCCAAATTATTTTTTTAAGTTGCGCCCGAG
  798. GCCATCAGGCCAAGGGCACGCCTGCTTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATA
  799. CATACTGTTCAGCCAGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTACTACGGGGGGTCTAAAAGCTGCA
  800. TGGGCTTTTGCTGGTCCTAAATACGGCAAGAGGTGGACAAAGTATGCTACAACAAAATTGTAGTGCGAAT
  801. GCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATTTAAAGACCCTTTTGAACCCCATTAGAGGCCCATC
  802. AACCCTGATCAGTT
  803.  
  804. >gi|2765594|emb|Z78469.1|PHZ78469 P.haynaldianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  805. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  806. AATCTGGAGGATCAGTTTACTTTAGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  807. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATTCGTTGCCCGGCGCAGTCTTGCGCCAAGTCATAT
  808. CACACATAATTGGAAGGGGGCGGCATGCGGTCTAGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGC
  809. AACGGATATCTCGGCTCTTCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCC
  810. TTAATGAGGCTGTCCATACATACTGTTCAGCCACAGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACG
  811. GGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTACCTAAATACGGCAAGAGGTGGACGAAGTATGCTACA
  812. ACAAAATGATAGTGCGAATGCCCAGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGA
  813. ACCCCATTAGAGGCCCATCAACCCATGATCAGTT
  814.  
  815. >gi|2765593|emb|Z78468.1|PAZ78468 P.adductum 5.8S rRNA gene and ITS1 and ITS2 DNA
  816. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATTGAGTT
  817. AATCTGGAGGATCAGTTTACTTTGGTCACTCATGGGAATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  818. AGCCTCCTTGGGAGCTTTCTTGATGGCGATCTGAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  819. ACACATAATTGGGAGGGGCAGCATGCTGCCTTGACCCTCCCCATATCATTTTTTTAACGACTCTCAGCTC
  820. CGGAACTCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTC
  821. TCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGG
  822. TACGGGGGGTCTAAGAGCAGCTGGGCTTTTGATGGACCTAAATACGGCAAGAGGTGGACGAAGTATGCTA
  823. CAACAAAATTATTGTGTGAATGCCCCGGGTTGTCGTATAGATGGGCCAGCATAATCTAAAGACCCTTTTG
  824. AACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  825.  
  826. >gi|2765592|emb|Z78467.1|PSZ78467 P.stonei 5.8S rRNA gene and ITS1 and ITS2 DNA
  827. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  828. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  829. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  830. ACACATAATTGGAAGGGGGTGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTGACAACTCTCAGCAA
  831. CGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  832. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGTACGCCTGCCTGGGC
  833. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTT
  834. GGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGTGCCTTTGGTGGTCCAAAATACGGCAAGA
  835. GGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGACCCGGGTTGTCGTATTAGCTGGGCCAGCA
  836. TAATCTAAAGACCCTCTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATATGTTTG
  837. CGACCCAGGTCAGGTGAGGCAACCCGCTGA
  838.  
  839. >gi|2765591|emb|Z78466.1|PPZ78466 P.philippinense 5.8S rRNA gene and ITS1 and ITS2 DNA
  840. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  841. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  842. AGCCTTCATGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  843. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTGTAACAACTCTCAGCA
  844. ACGGATATCTCGGCTCTTTGCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
  845. CTCTCCCTTAATGAGGCTGTCCATACATACAGTTCAGCCTGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  846. GCGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
  847. GCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCC
  848. TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCAGGTCAGG
  849. TGAGGCAACCC
  850.  
  851. >gi|2765590|emb|Z78465.1|PRZ78465 P.rothschildianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  852. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  853. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  854. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  855. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGCA
  856. ACGGATTTCTCGGTTCTTGAATCGATGAGGAACGCAGCGAAATGCGATAATTGGTGTGAATTGAAGAATC
  857. CCGTAAACCATCGAGTCTTTGAACGAAAGTTGCGCCCGAGGCCATCAGGCCAAGGGAACGCCTGCCTGGG
  858. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCGAGTGCGGATGTGAGTT
  859. TGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAG
  860. AGGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGC
  861. ATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  862. GC
  863.  
  864. >gi|2765589|emb|Z78464.1|PGZ78464 P.glanduliferum 5.8S rRNA gene and ITS1 and ITS2 DNA
  865. CGTAACAAGGTTTCCGTAGGTGAGCGGAAGGGTCATTGTTGAGATCACATAATAATTGATCGGTTGAGTC
  866. TGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTGCCATCGAGCCT
  867. CCTTGGGAGCTTTCTTGCTGGAGATCTAAACCCTTGCCCGGAGCAGTTTTGCGCCAAGTCATATGACACA
  868. TAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTCTTAACAACTCTCAGCAACGGA
  869. TATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATCCGATAAATGGTGTGAATTTCAGAATCCCGTG
  870. AACCATCGAGTCTTTGAACGCCAAGTTCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTT
  871. CGAATCAAATCTCTCCCTTAATGAGGCTGTCCAAACATACTGTTCAACCGGTTCGGATGTGAGTTTGGCC
  872. CCTTTTTCTTTGGGGCGGGGGGTCTAAGAACTTCATGGGCTTTTGGTGGTCCTAAAAACGGCAAGAGGTG
  873. GGCGGACTATTCTTCAACCAAATTTCTGTTCGGATTCCCCGGGCTTTCGTAATAGATGGGCCAGCATAAT
  874. CTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTGCGACC
  875. CCAGGTCAGGTGAGCAACCCGCTGAGTTTAAGC
  876.  
  877. >gi|2765588|emb|Z78463.1|PGZ78463 P.glanduliferum 5.8S rRNA gene and ITS1 and ITS2 DNA
  878. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGTTCATTGTTGAGATCACATAATCATTGTTCGGTTG
  879. AGTCTGGAGGATCAGTTTACTTTGGTCACCATGGGCATCTGCTCTTGTAGTGACCTGGATTGCCATCGAG
  880. CCTCCTTGGGAGCTTTCTTGCTGGGGATCTAAACCCTCGCCCGGGGGAGTTTTGCGCCAAGTCATATGAC
  881. ACATAATTGGGAGGGGGCGGCATGTTGCCTTGACCCTCCCCAAATTATTTTCTTAACAACTCTCAGCAAC
  882. GGATATCTCGGCTCTTGCATCGATGGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  883. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  884. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAACCGGTGCGGATGTGAGTTT
  885. GGCCCCTTTTTCTTTGGGGCGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGA
  886. GGTGGACGAACTATGCTGCAACAAAATTGCTGTGCGAATACCCCGGGTTGTCGTATTAGATGGGCCAGCA
  887. TAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTG
  888. CGACCCCAGATCAGGTGAGCAACCCGCTGAGTTTAAGC
  889.  
  890. >gi|2765587|emb|Z78462.1|PSZ78462 P.sukhakulii 5.8S rRNA gene and ITS1 and ITS2 DNA
  891. CGTCACGAGGTCTCCGGATGTGACCCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  892. AATCTGCAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  893. AGCCTCCTTGGGAGATTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  894. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  895. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  896. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  897. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTGCCTGGGCAT
  898. TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGG
  899. CCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGG
  900. TGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTA
  901. ATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCAT
  902.  
  903. >gi|2765586|emb|Z78461.1|PWZ78461 P.wardii 5.8S rRNA gene and ITS1 and ITS2 DNA
  904. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGGT
  905. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCAGTTGCTGCTGGAGTGACCTAGAATTTCCATCG
  906. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTACCCGGCGCAATTTTTCCCCCAGTCAAA
  907. TGACACATAATTGGTGGAGGGGGTGGCATTCTTCCCTGACCCTCCCCCAAATAATTTTTTCACAACTCTC
  908. AGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCACCGAAATCCGATAAATGGTGTGAATTCCAG
  909. AATCCCGTGAACCATCGAGTCTTTGAACCCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGAACGCCTGCC
  910. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGCCTGTCCATACATCCTGTTCAGCCGGTGCGGATGTG
  911. AGTTTGCCCCCTTGTTCTTTGGTACGGGGGGTCTAAGACCTGCATGGGCTTTTGATGGTCCTAAATACGG
  912. CAAGAGGTGGACGAACTATGCTACACCAAAATTGTTGTCCAAAGCCCCCGGGTTGTCGTATAAGATGGGC
  913. CACCGTAATCTGAAGACCCTTTGAACCCCATTGGAGCCCATCAACCCATGATCAGTTGATGCCATTGTTG
  914. CGACCCAGTCAGTGAGCAAGCCGCTGAGTTAA
  915.  
  916. >gi|2765585|emb|Z78460.1|PCZ78460 P.ciliolare 5.8S rRNA gene and ITS1 and ITS2 DNA
  917. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  918. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  919. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  920. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  921. AGCAACGGGATATCTCGGCTCTTGCATCGGATGGAGGAACGCAGCGAAATGCGATAAATGGTGTGAATTG
  922. CAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
  923. GCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGAT
  924. GTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCCAAATA
  925. CGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATG
  926. GGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCA
  927. TTTGGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTA
  928.  
  929. >gi|2765584|emb|Z78459.1|PDZ78459 P.dayanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  930. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  931. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  932. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  933. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  934. AGCAACGGATATCTCGGCTCTTGCATCGGATGGAGGAACGCAGCGAAATTGCGATAAATTGGTGTGAATT
  935. GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCC
  936. TGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGA
  937. TGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAAT
  938. ACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGAT
  939. GGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCC
  940. ATTTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTT
  941.  
  942. >gi|2765583|emb|Z78458.1|PHZ78458 P.hennisianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  943. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  944. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  945. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCGTA
  946. CGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCAAATTATTTTTTAACAACTCTCA
  947. GCAACGGATATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGA
  948. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTG
  949. GGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAG
  950. TTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCA
  951. AGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCA
  952. CCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGG
  953. TTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTG
  954.  
  955. >gi|2765582|emb|Z78457.1|PCZ78457 P.callosum 5.8S rRNA gene and ITS1 and ITS2 DNA
  956. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  957. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTTCTGTTGTAGTGACCTAGAATTTCCATCG
  958. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTTCCCCCAGTCAAA
  959. TGGCACATAATTGGTGGAGGGGGTGGCATTCTTCCCTGACCCTCCCCCAAATATTTTTTTAACAACTCTC
  960. AACAACGGATATCTCGGCTCTTTCATCGGATGAAGGACCGCAGCGAAATGCGATAAATGGTGTGAATTGC
  961. AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTG
  962. CCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATG
  963. TGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATAC
  964. GGCAAGAGGTGGACGAACTATGCTACAACAAAATCGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGG
  965. GCCACCGTAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCAT
  966. TTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAG
  967.  
  968. >gi|2765581|emb|Z78456.1|PTZ78456 P.tonsum 5.8S rRNA gene and ITS1 and ITS2 DNA
  969. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  970. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTTGCCATC
  971. GAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAT
  972. ATGACACATAATTGGTGGAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCT
  973. CAGCAACGGATATCTCCGGTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGATTGCAG
  974. AATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCT
  975. GGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGA
  976. GTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGC
  977. AAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCC
  978. ACCGTAATCTGAAGACCCTTTTGGACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTG
  979. GGTTGCGACCCAGGTCAGGTGAGGCAACCCTGAGTTTAGC
  980.  
  981. >gi|2765580|emb|Z78455.1|PJZ78455 P.javanicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  982. CGTAACCAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAGATCACATAAAAATTGATCGAGTT
  983. AATCTGGAGGAACTTTTTACTTTGGTCACCCATGAACAATTTCTTTTGGAGTGACCTAGAATTTCCATCG
  984. AACCCCCTTGGGAACTTTCTTTTTGGCGAGAACTAAACCCTTTCCCGGCGCAGTTTTTCCCCCAATCAAA
  985. TTACACAAAAATGGTGGAGGGGGTGGCATCCTTCCCTTACCCTCCCCCAAATAATTTTTTAACAACTCTC
  986. AGCAACGGATATCTCGGCTCTTGCATCGGTTGAAGAACCAGCGAAATGCGATAAATGGTGTGAATTGCAG
  987. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  988. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  989. AGTTTGGCCCCTTGTTCTTTGGCACGGGGGGTCTAAGAGCTTCATGGGCTTTTGATGGTCCTAAATACGG
  990. CAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  991. CACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  992. GGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  993.  
  994. >gi|2765579|emb|Z78454.1|PFZ78454 P.fowliei 5.8S rRNA gene and ITS1 and ITS2 DNA
  995. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  996. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTACCATCG
  997. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTTCTCCAAGTCATT
  998. TGACACATAATCGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCCCACTATTGTTAACAACTCTCAT
  999. CAACGGAACTCATGCGATAAATGGTGTGATTTGCAGAATCCCGTGAACCATCGAGTCTGTGAACGCAAGT
  1000. TGCGGCCGAGGCCATCAGACCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAG
  1001. GCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTCTGGTACGGGGGGTCT
  1002. AAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTG
  1003. TTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGCCCCTTTTGAACCCATTGG
  1004. AGGCCCATCAACCNCATGATCAGTTGATGGCCATTTGGATGCGACCCCAGGTCAGGTGAGGCAAC
  1005.  
  1006. >gi|2765578|emb|Z78453.1|PSZ78453 P.schoseri 5.8S rRNA gene and ITS1 and ITS2 DNA
  1007. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1008. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAGTTGCCATCG
  1009. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAACTCATT
  1010. TGACACATAACTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAAATTATTTTTTAACAACTCTC
  1011. AGCAACCGGATATCTCAGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCA
  1012. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGC
  1013. CTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGT
  1014. GAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACG
  1015. GCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGG
  1016. CCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATT
  1017. TGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  1018.  
  1019. >gi|2765577|emb|Z78452.1|PBZ78452 P.bougainvilleanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1020. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1021. AATCTGGAGGATCTATTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCA
  1022. AGCCTCCTTGGGAGCTTTCTTTTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  1023. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  1024. AGCAACGGATATCTCGGCTCTTGAATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAG
  1025. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  1026. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  1027. AGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  1028. CAAGAGGTGGATGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  1029. CACTGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  1030. GGATGCGACCCCAGGTCAGGTGAGGCAACCGCTGAGTTTAGCA
  1031.  
  1032. >gi|2765576|emb|Z78451.1|PHZ78451 P.hookerae 5.8S rRNA gene and ITS1 and ITS2 DNA
  1033. CGTAACAAGGTTTCCGTAGGTGTACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  1034. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGTAGTGACCTAGATTTCCATGGA
  1035. GCCCCCCTGGGAGCTTTCTTGCTGGCGAGATCTAAACCCGTGCCCGGCGCAGTTTTGCGCCAAGTCATAT
  1036. GACACATAATTGGTGTAGGGGGCGGGCATCCTGCCCTGACCCTCCCCAAAGTATTTTTTGCAACTCTCAA
  1037. CAACGGAAATCTCGCTCTTTCATCGATGAAGAACCAGCGAAATCGATAAATGGTGTGAATTGCAGAATCC
  1038. CGTGAACCATCGAGTCTTTGAACCCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACCCCTCCCTGGGC
  1039. ATCGCGAGTCAAATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCACCCGGTGCGGATGTGAGTTT
  1040. GCCCCCTTGTTCTTTGGTACGGGGGGTCTAAGACCTGCATGGGATTTTGATGGTCCTAAAAACGGCAAGA
  1041. GGTGGACGAACTATCCCTACAATAAAATTGTTGTGCGAAGCCCCCGGGTTGTCGTATTAGATGGGCCACC
  1042. GTAATCTGAAGACCCTATAGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGATG
  1043. CGACACCAGTCAGTGAGCAACCAGCTGAGC
  1044.  
  1045. >gi|2765575|emb|Z78450.1|PPZ78450 P.papuanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1046. GGAAGGATCATTGCTGATATCACATAATAATTGATCGAGTTAAGCTGGAGGATCTGTTTACTTTGGTCAT
  1047. CCATGAGCATTTACTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGCTTTCTTGTTGCCGA
  1048. GATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGCAT
  1049. CCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGA
  1050. TGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACG
  1051. CAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTCCGAGTCATATCTCTCCCCTA
  1052. ACGAGGCTGTCCATACATACTGTTCATCCGGTGCGGATGTGAGTGTGGCCCCTTGTTCTTTGGTCCGGGG
  1053. GGTCTAAGAACTGCATGGGCATATGATGGTCCTCAAAACTGGCAAGAGGTGGACGAACTATGCTACAACC
  1054. AAATTGTTGTGCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGTAGACCCTGTTGAACC
  1055. CCATTGGAGGACCATCAACCCATGATCAGTTGATGACCATGTGTTGCGACCCCAGATCAGCTGAGCAACC
  1056. CCTGAG
  1057.  
  1058. >gi|2765574|emb|Z78449.1|PMZ78449 P.mastersianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1059. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1060. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1061. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAACTCATT
  1062. TGACACATAATTGGTGAAGGGTGGCATCCTGCCCTGACCCTCCCCCAAATTATTTTTTTAACAACTCTCA
  1063. GCAACGGATATCTCAGCTCTTGCATCGATGAAGAACGCAGCGAAAATGCGATAAATGGTGTGAATTGCAG
  1064. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  1065. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  1066. AGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  1067. CAAGAGGTGGACGAACTATGCTACAACTAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  1068. CACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  1069. GGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTATGC
  1070.  
  1071. >gi|2765573|emb|Z78448.1|PAZ78448 P.argus 5.8S rRNA gene and ITS1 and ITS2 DNA
  1072. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1073. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
  1074. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTTCCCGGCGCAGTTTTGCGCCAAGTCGTA
  1075. TGACACATAATTGGTGAAGGGGGGTGGCATCCTTCCCTTGACCCTCCCCAAATTATTTTTTTAACAACTC
  1076. TCAGCAACGGATATCTCAGCTCTTGCATCGGATGGAAGAACGCACCGAAATGCGATAAATGGTGTGAATT
  1077. GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCC
  1078. TGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGA
  1079. TGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAAT
  1080. ACGGCAAGAGGTGGACGAACTATGCTACAANAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGAT
  1081. GGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAGCCCATGATCAGTTGATGGCC
  1082. ATTTGGNTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGG
  1083.  
  1084. >gi|2765572|emb|Z78447.1|PVZ78447 P.venustum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1085. CGTAACAAGGATTCCGTAGGTGAACCTGCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGTA
  1086. ATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTCCTGTTGAAGTGACCTAGAGTTGCCATCGA
  1087. GCCTCCCTGGGAGCTTTCTTGTTGGCGAGAACTAAACCCTTACCCGGCGCAATTTTGCCCCCAGTCAAAT
  1088. GACACATAAGTGGTGAAGGGGGTGGCATCCTATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAATGC
  1089. GATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT
  1090. CAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATAC
  1091. TGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGC
  1092. TTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACACCAAAATTGTTGTGCAAAGGCCCC
  1093. GGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCC
  1094. ATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGTCAGGTGAGGCAACCCGCTGAGTTTAAGC
  1095.  
  1096. >gi|2765571|emb|Z78446.1|PAZ78446 P.acmodontum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1097. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1098. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTCCTGTTGAAGTGACCTAGATTTGCCATCG
  1099. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  1100. TGACACATAATTGGTGAAGGGGGTGGCATCCTCCCCAAATAATTTTTTAACAACTCTCAGCAACGGATAC
  1101. TCGGCTCTTCATCGATGGAGGACCAGCGAAATTGCGATAATGGTGTGATTGCAGAATCCCGTGAACATCG
  1102. AGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGATTGCGAGTCATA
  1103. TCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCAGATGTGAGTTTGGCCCCTTGTTCT
  1104. TCGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGCCCTAAATACGGCAAGAGGTGGACGAACTA
  1105. TGCTACAACAAAATTGTTGTGCAAAGGCTCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACC
  1106. CTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCAGGTCAG
  1107. GTGAGGCAACCC
  1108.  
  1109. >gi|2765570|emb|Z78445.1|PUZ78445 P.urbanianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1110. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
  1111. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
  1112. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
  1113. TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
  1114. AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
  1115. TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
  1116. CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  1117. TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
  1118. GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
  1119. TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
  1120. GTGAGCAACAGCTGT
  1121.  
  1122. >gi|2765569|emb|Z78444.1|PAZ78444 P.appletonianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1123. CGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1124. AATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1125. AGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCAATCAAATTACACAAA
  1126. ATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACAACTCTCAGCAACGGA
  1127. TATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTG
  1128. AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTG
  1129. CGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCC
  1130. CCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTG
  1131. GACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAGATGGGCCACCGATAT
  1132. CTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCCATT
  1133.  
  1134. >gi|2765568|emb|Z78443.1|PLZ78443 P.lawrenceanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1135. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1136. AATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1137. AGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGCCACANNNNN
  1138. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  1139. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  1140. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGAAATGCGATAATGGTGTGAATTGCAGAATCCCGTGA
  1141. ACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGC
  1142. GAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTGGCC
  1143. CCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTG
  1144. GACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCATAAT
  1145. CTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGAC
  1146. CCAGTCAGGTGAGG
  1147.  
  1148. >gi|2765567|emb|Z78442.1|PBZ78442 P.bullenianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1149. GTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTG
  1150. TTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGC
  1151. TTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCATATGACACATAATTGGT
  1152. GAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTC
  1153. GGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCAT
  1154. CGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGGGAAT
  1155. CATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGATGTGAGTTTGGCCCCTTG
  1156. TTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAACGGCAAGAGGTGGACGA
  1157. ACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGAA
  1158. GACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCATTTGTTGCGACCCCAGT
  1159. CAGCTGAGCAACCCGCTGAGT
  1160.  
  1161. >gi|2765566|emb|Z78441.1|PSZ78441 P.superbiens 5.8S rRNA gene and ITS1 and ITS2 DNA
  1162. GGAAGGTCATTGCCGATATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCC
  1163. ATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGA
  1164. TCTAAACCCTTGCCCGGCGGAGTTGTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGCATCC
  1165. TGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATG
  1166. AAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCA
  1167. AGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAAC
  1168. GAGGCTGTCCATACATACTGTTCATCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGG
  1169. TCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAA
  1170. TTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCA
  1171. TTGGAGGCCCATCAACCCATGATCAGTTGATGACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCT
  1172. GAG
  1173.  
  1174. >gi|2765565|emb|Z78440.1|PPZ78440 P.purpuratum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1175. CGTAACAAGGTTTCCGTAGGTGGACCTCCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGT
  1176. AATCTGGAGGATCTGCATATTTTGGTCACCCATGGGCAATTTCTGTTGTAGTGACCTAGAATTTCCATCG
  1177. ACCCTCCTTGGGAGCATTCTTGTTGGCGAGAACTAAACCCTTACCCGGCGCAGTTTTTCCCCCAATCAAA
  1178. TTACACAAAAATGGTGGAGGGGGTGGCATATCTTCCCTTACCCTCCCCCAAATAATTTTTTAACAACTCT
  1179. CAGCAACGGATATCTCAGCTCTTGCATCGTTGAAGAACCCACCGAAATGCGATAAATGGTGTGAATTGCA
  1180. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGC
  1181. CTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGT
  1182. GAGTTTGGCCCCTTGTTCTTTGCTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACG
  1183. GCAAGAGGTGGACGAACTATGCTACAGCAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGG
  1184. CCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATT
  1185. TGGTTGCGACCCCAGGTCAGGTGAGGCAACCCCTGAGTTTAGCA
  1186.  
  1187. >gi|2765564|emb|Z78439.1|PBZ78439 P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1188. CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGC
  1189. ATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAA
  1190. CCCCTGCCCGGCGGAGTTGGGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGTAATCCTGCCC
  1191. TGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAA
  1192. CGCAGCGAAATGCGATAATGGTGTGAATTGCAGAATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCG
  1193. CCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTG
  1194. TCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGA
  1195. GCTGCATGGGCTTTGGATGGTCCTAAATACGGAAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGT
  1196. GCAAATGCCCCGGTTGGCCGTTTAGTTGGGCC

Télécharger